Bio::Perl.3pm

Langue: en

Version: 2008-01-11 (mandriva - 01/05/08)

Section: 3 (Bibliothèques de fonctions)

NAME

Bio::Perl - Functional access to BioPerl for people who don't know objects

SYNOPSIS

   use Bio::Perl;
 
 
   # will guess file format from extension
   $seq_object = read_sequence($filename);
 
 
   # forces genbank format
   $seq_object = read_sequence($filename,'genbank');
 
 
   # reads an array of sequences
   @seq_object_array = read_all_sequences($filename,'fasta');
 
 
   # sequences are Bio::Seq objects, so the following methods work
   # for more info see Bio::Seq, or do 'perldoc Bio/Seq.pm'
 
 
   print "Sequence name is ",$seq_object->display_id,"\n";
   print "Sequence acc  is ",$seq_object->accession_number,"\n";
   print "First 5 bases is ",$seq_object->subseq(1,5),"\n";
 
 
   # get the whole sequence as a single string
 
 
   $sequence_as_a_string = $seq_object->seq();
 
 
   # writing sequences
 
 
   write_sequence(">$filename",'genbank',$seq_object);
 
 
   write_sequence(">$filename",'genbank',@seq_object_array);
 
 
   # making a new sequence from just a string
 
 
   $seq_object = new_sequence("ATTGGTTTGGGGACCCAATTTGTGTGTTATATGTA",
       "myname","AL12232");
 
 
   # getting a sequence from a database (assumes internet connection)
 
 
   $seq_object = get_sequence('swissprot',"ROA1_HUMAN");
 
 
   $seq_object = get_sequence('embl',"AI129902");
 
 
   $seq_object = get_sequence('genbank',"AI129902");
 
 
   # BLAST a sequence (assummes an internet connection)
 
 
   $blast_report = blast_sequence($seq_object);
 
 
   write_blast(">blast.out",$blast_report);
 
 

DESCRIPTION

Easy first time access to BioPerl via functions.

FEEDBACK


Mailing Lists

User feedback is an integral part of the evolution of this and other Bioperl modules. Send your comments and suggestions preferably to one of the Bioperl mailing lists. Your participation is much appreciated.

   bioperl-l@bioperl.org
 
 

Reporting Bugs

Report bugs to the Bioperl bug tracking system to help us keep track the bugs and their resolution. Bug reports can be submitted via the web:

   http://bugzilla.open-bio.org/
 
 

AUTHOR - Ewan Birney

Email birney@ebi.ac.uk

APPENDIX

The rest of the documentation details each of the object methods. Internal methods are usually preceded with a _

read_sequence

  Title   : read_sequence
  Usage   : $seq = read_sequence('sequences.fa')
            $seq = read_sequence($filename,'genbank');
 
 
            # pipes are fine
            $seq = read_sequence("my_fetching_program $id |",'fasta');
 
 
  Function: Reads the top sequence from the file. If no format is given, it will
            try to guess the format from the filename. If a format is given, it
            forces that format. The filename can be any valid perl open() string
            - in particular, you can put in pipes
 
 
  Returns : A Bio::Seq object. A quick synopsis:
            $seq_object->display_id - name of the sequence
            $seq_object->seq        - sequence as a string
 
 
  Args    : Two strings, first the filename - any Perl open() string is ok
            Second string is the format, which is optional
 
 

For more information on Seq objects see Bio::Seq.

read_all_sequences

  Title   : read_all_sequences
  Usage   : @seq_object_array = read_all_sequences($filename);
            @seq_object_array = read_all_sequences($filename,'genbank');
 
 
  Function: Just as the function above, but reads all the sequences in the
            file and loads them into an array.
 
 
            For very large files, you will run out of memory. When this
            happens, you've got to use the SeqIO system directly (this is
            not so hard! Don't worry about it!).
 
 
  Returns : array of Bio::Seq objects
 
 
  Args    : two strings, first the filename (any open() string is ok)
            second the format (which is optional)
 
 

See Bio::SeqIO and Bio::Seq for more information

write_sequence

  Title   : write_sequence
  Usage   : write_sequence(">new_file.gb",'genbank',$seq)
            write_sequence(">new_file.gb",'genbank',@array_of_sequence_objects)
 
 
  Function: writes sequences in the specified format
 
 
  Returns : true
 
 
  Args    : filename as a string, must provide an open() output file
            format as a string
            one or more sequence objects
 
 

new_sequence

  Title   : new_sequence
  Usage   : $seq_obj = new_sequence("GATTACA", "kino-enzyme");
 
 
  Function: Construct a sequency object from sequence string
  Returns : A Bio::Seq object
 
 
  Args    : sequence string
            name string (optional, default "no-name-for-sequence")
            accession - accession number (optional, no default)
 
 

blast_sequence

  Title   : blast_sequence
  Usage   : $blast_result = blast_sequence($seq)
            $blast_result = blast_sequence('MFVEGGTFASEDDDSASAEDE');
 
 
  Function: If the computer has Internet accessibility, blasts
            the sequence using the NCBI BLAST server against nrdb.
 
 
            It chooses the flavour of BLAST on the basis of the sequence.
 
 
            This function uses Bio::Tools::Run::RemoteBlast, which itself
            use Bio::SearchIO - as soon as you want to know more, check out
            these modules
  Returns : Bio::Search::Result::GenericResult.pm
 
 
  Args    : Either a string of protein letters or nucleotides, or a
            Bio::Seq object
 
 

write_blast

  Title   : write_blast
  Usage   : write_blast($filename,$blast_report);
 
 
  Function: Writes a BLAST result object (or more formally
            a SearchIO result object) out to a filename
            in BLAST-like format
 
 
  Returns : none
 
 
  Args    : filename as a string
            Bio::SearchIO::Results object
 
 

get_sequence

  Title   : get_sequence
  Usage   : $seq_object = get_sequence('swiss',"ROA1_HUMAN");
 
 
  Function: If the computer has Internet access this method gets
            the sequence from Internet accessible databases. Currently
            this supports Swissprot ('swiss'), EMBL ('embl'), GenBank
            ('genbank'), GenPept ('genpept'), and RefSeq ('refseq').
 
 
            Swissprot and EMBL are more robust than GenBank fetching.
 
 
            If the user is trying to retrieve a RefSeq entry from
            GenBank/EMBL, the query is silently redirected.
 
 
  Returns : A Bio::Seq object
 
 
  Args    : database type - one of swiss, embl, genbank, genpept, or
            refseq
 
 

translate

  Title   : translate
  Usage   : $seqobj = translate($seq_or_string_scalar)
 
 
  Function: translates a DNA sequence object OR just a plain
            string of DNA to amino acids
  Returns : A Bio::Seq object
 
 
  Args    : Either a sequence object or a string of
            just DNA sequence characters
 
 

translate_as_string

  Title   : translate_as_string
  Usage   : $seqstring = translate_as_string($seq_or_string_scalar)
 
 
  Function: translates a DNA sequence object OR just a plain
            string of DNA to amino acids
  Returns : A string of just amino acids
 
 
  Args    : Either a sequence object or a string of
            just DNA sequence characters
 
 

reverse_complement

  Title   : reverse_complement
  Usage   : $seqobj = reverse_complement($seq_or_string_scalar)
 
 
  Function: reverse complements a string or sequence argument
            producing a Bio::Seq - if you want a string, you
            can use reverse_complement_as_string
  Returns : A Bio::Seq object
 
 
  Args    : Either a sequence object or a string of
            just DNA sequence characters
 
 

revcom

  Title   : revcom
  Usage   : $seqobj = revcom($seq_or_string_scalar)
 
 
  Function: reverse complements a string or sequence argument
            producing a Bio::Seq - if you want a string, you
            can use reverse_complement_as_string
 
 
            This is an alias for reverse_complement
  Returns : A Bio::Seq object
 
 
  Args    : Either a sequence object or a string of
            just DNA sequence characters
 
 

reverse_complement_as_string

  Title   : reverse_complement_as_string
  Usage   : $string = reverse_complement_as_string($seq_or_string_scalar)
 
 
  Function: reverse complements a string or sequence argument
            producing a string
  Returns : A string of DNA letters
 
 
  Args    : Either a sequence object or a string of
            just DNA sequence characters
 
 

revcom_as_string

  Title   : revcom_as_string
  Usage   : $string = revcom_as_string($seq_or_string_scalar)
 
 
  Function: reverse complements a string or sequence argument
            producing a string
  Returns : A string of DNA letters
 
 
  Args    : Either a sequence object or a string of
            just DNA sequence characters