Bio::Restriction::Analysis.3pm

Langue: en

Version: 2009-03-10 (debian - 07/07/09)

Section: 3 (Bibliothèques de fonctions)

NAME

Bio::Restriction::Analysis - cutting sequences with restriction enzymes

SYNOPSIS

   # analyze a DNA sequence for restriction enzymes
   use Bio::Restriction::Analysis;
   use Bio::PrimarySeq;
   use Data::Dumper;
 
   # get a DNA sequence from somewhere
   my $seq = Bio::PrimarySeq->new
       (-seq =>'AGCTTAATTCATTAGCTCTGACTGCAACGGGCAATATGTCTC',
        -primary_id => 'synopsis',
        -molecule => 'dna');
 
   # now start an analysis.
   # this is using the default set of enzymes
   my $ra = Bio::Restriction::Analysis->new(-seq=>$seq);
 
   # find unique cutters. This returns a
   # Bio::Restriction::EnzymeCollection object
   my $enzymes = $ra->unique_cutters;
   print "Unique cutters: ", join (', ', 
       map {$_->name} $enzymes->unique_cutters), "\n";
 
   # AluI is one them. Where does it cut?
   # This is will return an array of the sequence strings
 
   my $enz = 'AluI';
   my @frags = $ra->fragments($enz);
   # how big are the fragments?
   print "AluI fragment lengths: ", join(' & ', map {length $_} @frags), "\n";
 
   # You can also bypass fragments and call sizes directly:
   # to see all the fragment sizes
   print "All sizes: ", join " ", $ra->sizes($enz), "\n";
   # to see all the fragment sizes sorted by size like on a gel
   print "All sizes, sorted ", join (" ", $ra->sizes($enz, 0, 1)), "\n";
 
   # how many times does each enzyme cut
   my $cuts = $ra->cuts_by_enzyme('BamHI');
   print "BamHI cuts $cuts times\n";
 
   # How many enzymes do not cut at all?
   print "There are ", scalar $ra->zero_cutters->each_enzyme,
         " enzymes that do not cut\n";
 
   # what about enzymes that cut twice?
   my $two_cutters = $ra->cutters(2);
   print join (" ", map {$_->name} $two_cutters->each_enzyme),
       " cut the sequence twice\n";
 
   # what are all the enzymes that cut, and how often do they cut
   printf "\n%-10s%s\n", 'Enzyme', 'Number of Cuts';
   my $all_cutters = $ra->cutters;
   map {
       printf "%-10s%s\n", $_->name, $ra->cuts_by_enzyme($_->name)
   } $all_cutters->each_enzyme;
 
   # Finally, we can interact the restriction enzyme object by
   # retrieving it from the collection object see the docs for
   # Bio::Restriction::Enzyme.pm
   my $enzobj = $enzymes->get_enzyme($enz);
 
 

DESCRIPTION

Bio::Restriction::Analysis describes the results of cutting a DNA sequence with restriction enzymes.

To use this module you can pass a sequence object and optionally a Bio::Restriction::EnzymeCollection that contains the enzyme(s) to cut the sequences with. There is a default set of enzymes that will be loaded if you do not pass in a Bio::Restriction::EnzymeCollection.

To cut a sequence, set up a Restriction::Analysis object with a sequence like this:

   use Bio::Restriction::Analysis;
   my $ra = Bio::Restriction::Analysis->new(-seq=>$seqobj);
 
 

or

   my $ra = Bio::Restriction::Analysis->new
       (-seq=>$seqobj, -enzymes=>$enzs);
 
 

Then, to get the fragments for a particular enzyme use this:

   @fragments = $ra->fragments('EcoRI');
 
 

Note that the naming of restriction enzymes is that the last numbers are usually Roman numbers (I, II, III, etc). You may want to use something like this:

   # get a reference to an array of unique (single) cutters
   $singles = $re->unique_cutters;
   foreach my $enz ($singles->each_enzyme) {
       @fragments = $re->fragments($enz);
       ... do something here ...
   }
 
 

Note that if your sequence is circular, the first and last fragment will be joined so that they are the appropriate length and sequence for further analysis. This fragment will also be checked for cuts by the enzyme(s). However, this will change the start of the sequence!

There are two separate algorithms used depending on whether your enzyme has ambiguity. The non-ambiguous algoritm is a lot faster, and if you are using very large sequences you should try and use this algorithm. If you have a large sequence (e.g. genome) and want to use ambgiuous enzymes you may want to make seperate Bio::Restriction::Enzyme objects for each of the possible alternatives and make sure that you do not set is_ambiguous!

This version should correctly deal with overlapping cut sites in both ambiguous and non-ambiguous enzymes.

I have tried to write this module with speed and memory in mind so that it can be effectively used for large (e.g. genome sized) sequence. This module only stores the cut positions internally, and calculates everything else on an as-needed basis. Therefore when you call fragment_maps (for example), there may be another delay while these are generated.

FEEDBACK

Mailing Lists

User feedback is an integral part of the evolution of this and other Bioperl modules. Send your comments and suggestions preferably to one of the Bioperl mailing lists. Your participation is much appreciated.
   bioperl-l@bioperl.org                  - General discussion
   http://bioperl.org/wiki/Mailing_lists  - About the mailing lists
 
 

Reporting Bugs

Report bugs to the Bioperl bug tracking system to help us keep track the bugs and their resolution. Bug reports can be submitted via the web:
   http://bugzilla.open-bio.org/
 
 

AUTHOR

Rob Edwards, redwards@utmem.edu, Steve Chervitz, sac@bioperl.org

CONTRIBUTORS

Heikki Lehvaslaiho, heikki-at-bioperl-dot-org Copyright (c) 2003 Rob Edwards. Some of this work is Copyright (c) 1997-2002 Steve A. Chervitz. All Rights Reserved.

This module is free software; you can redistribute it and/or modify it under the same terms as Perl itself.

SEE ALSO

Bio::Restriction::Enzyme, Bio::Restriction::EnzymeCollection

APPENDIX

Methods beginning with a leading underscore are considered private and are intended for internal use by this module. They are not considered part of the public interface and are described here for documentation purposes only.

new

  Title     : new
  Function  : Initializes the restriction enzyme object
  Returns   : The Restriction::Analysis object 
  Arguments : 
 
              $re_anal->new(-seq=$seqobj, 
                  -enzymes=>Restriction::EnzymeCollection object)
              -seq requires a Bio::PrimarySeq object
              -enzymes is optional.
               If ommitted it will use the default set of enzymes
 
 

This is the place to start. Pass in a sequence, and you will be able to get the fragments back out. Several other things are available like the number of zero cutters or single cutters.

Methods to set parameters

seq

  Title    : seq
  Usage    : $ranalysis->seq($newval);
  Function : get/set method for the  sequence to be cut
  Example  : $re->seq($seq);
  Returns  : value of seq
  Args     : A Bio::PrimarySeqI dna object (optional)
 
 

enzymes

  Title    : enzymes
  Usage    : $re->enzymes($newval)
  Function : gets/Set the restriction enzyme enzymes
  Example  : $re->enzymes('EcoRI')
  Returns  : reference to the collection
  Args     : an array of Bio::Restriction::EnzymeCollection and/or
             Bio::Restriction::Enzyme objects
 
 

The default object for this method is Bio::Restriction::EnzymeCollection. However, you can also pass it a list of Bio::Restriction::Enzyme objects - even mixed with Collection objects. They will all be stored into one collection.

Perform the analysis

cut

  Title    : cut
  Usage    : $re->cut()
  Function : Cut the sequence with the enzymes
  Example  : $re->cut(); $re->cut('single'); or $re->cut('multiple', $enzymecollection);
  Returns  : $self
  Args     : 'single' (optional), 'multiple' with enzyme collection.
 
 

An explicit cut method is needed to pass arguments to it.

There are two varieties of cut. Single is the default, and need not be explicitly called. This cuts the sequence with each enzyme separately.

Multiple cuts a sequence with more than one enzyme. You must pass it a Bio::Restriction::EnzymeCollection object of the set of enzymes that you want to use in the double digest. The results will be stored as an enzyme named ``multiple_digest'', so you can use all the retrieval methods to get the data.

If you want to use the default setting there is no need to call cut directly. Every method in the class that needs output checks the object's internal status and recalculates the cuts if needed.

Note: cut doesn't now re-initialize everything before figuring out cuts. This is so that you can do multiple digests, or add more data or whatever. You'll have to use new to reset everything.

See also the comments in above about ambiguous and non-ambiguous sequences.

mulitple_digest

  Title     : multiple_digest
  Function  : perform a multiple digest on a sequence
  Returns   : $self so you can go and get any of the other methods
  Arguments : An enzyme collection
 
  Multiple digests can use 1 or more enzymes, and the data is stored
  in as if it were an enzyme called multiple_digest. You can then
  retrieve information about multiple digests from any of the other
  methods.
 
  You can use this method in place of $re->cut('multiple', $enz_coll);
 
 

Query the results of the analysis

positions

   Title    : positions
   Function : Retrieve the positions that an enzyme cuts at
   Returns  : An array of the positions that an enzyme cuts at
            : or an empty array if the enzyme doesn't cut
   Arguments: An enzyme name to retrieve the positions for
   Comments : The cut occurs after the base specified.
 
 

fragments

   Title    : fragments
   Function : Retrieve the fragments that we cut
   Returns  : An array of the fragments retrieved. 
   Arguments: An enzyme name to retrieve the fragments for
 
 

For example this code will retrieve the fragments for all enzymes that cut your sequence

   my $all_cutters = $analysis->cutters;
   foreach my $enz ($$all_cutters->each_enzyme}) {
       @fragments=$analysis->fragments($enz);
   }
 
 

fragment_maps

   Title     : fragment_maps
   Function  : Retrieves fragment sequences with start and end
               points. Useful for feature construction.
 
   Returns   : An array containing a hash reference for each fragment,
               containing the start point, end point and DNA
               sequence. The hash keys are 'start', 'end' and
               'seq'. Returns an empty array if not defined.
 
   Arguments : An enzyme name, enzyme object, 
               or enzyme collection to retrieve the fragments for.
 
 

If passes an enzyme collection it will return the result of a multiple digest. This : will also cause the special enzyme 'multiple_digest' to be created so you can get : other information about this multiple digest. (TMTOWTDI).

There is a minor problem with this and $self->fragments that I haven't got a good answer for (at the moment). If the sequence is not cut, do we return undef, or the whole sequence?

For linear fragments it would be good to return the whole sequence. For circular fragments I am not sure.

At the moment it returns the whole sequence with start of 1 and end of length of the sequence. For example:

   use Bio::Restriction::Analysis;
   use Bio::Restriction::EnzymeCollection;
   use Bio::PrimarySeq;
 
   my $seq = Bio::PrimarySeq->new
       (-seq =>'AGCTTAATTCATTAGCTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATCCAAAAAAGAGTGAGCTTCTGAT',
        -primary_id => 'synopsis',
        -molecule => 'dna');
 
   my $ra = Bio::Restriction::Analysis->new(-seq=>$seq);
 
   my @gel;
   my @bam_maps = $ra->fragment_maps('BamHI');
   foreach my $i (@bam_maps) {
      my $start = $i->{start};
      my $end = $i->{end};
      my $sequence = $i->{seq};
      push @gel, "$start--$sequence--$end";
      @gel = sort {length $b <=> length $a} @gel;
   }
   print join("\n", @gel) . "\n";
 
 

sizes

   Title    : sizes
   Function : Retrieves an array with the sizes of the fragments
   Returns  : Array that has the sizes of the fragments ordered from 
              largest to smallest like they would appear in a gel.
   Arguments: An enzyme name to retrieve the sizes for is required and
              kilobases to the nearest 0.1 kb, else it will be in
              bp. If the optional third entry is set the results will
              be sorted.
 
 

This is designed to make it easy to see what fragments you should get on a gel!

You should be able to do these:

   # to see all the fragment sizes,
   print join "\n", @{$re->sizes($enz)}, "\n";
   # to see all the fragment sizes sorted
   print join "\n", @{$re->sizes($enz, 0, 1)}, "\n";
   # to see all the fragment sizes in kb sorted
   print join "\n", @{$re->sizes($enz, 1, 1)}, "\n";
 
 

How many times does enzymes X cut?

cuts_by_enzyme

  Title     : cuts_by_enzyme
  Function  : Return the number of cuts for an enzyme
  Returns   : An integer with the number of times each enzyme cuts.
              Returns 0 if doesn't cut or undef if not defined
  Arguments : An enzyme name string
 
 

Which enzymes cut the sequence N times?

cutters

  Title     : cutters
  Function  : Find enzymes that cut a given number of times
  Returns   : a Bio::Restriction::EnzymeCollection
  Arguments : 1. exact time or lower limit,
                 non-negative integer, optional
              2. upper limit, non-negative integer,
                 larger or equalthan first, optional
 
 

If no argumets are given, the method returns all enzymes that do cut the sequence. The argument zero, '0', is same as method zero_cutters(). The argument one, '1', corresponds to unique_cutters. If either of the limits is larger than number of cuts any enzyme cuts the sequence, the that limit is automagically lowered. The method max_cuts() gives the largest number of cuts.

See Also : unique_cutters, zero_cutters, max_cuts

unique_cutters

  Title     : unique_cutters
  Function  : A special case if cutters() where enzymes only cut once
  Returns   : a Bio::Restriction::EnzymeCollection
  Arguments : -
 
 

See also: cutters, zero_cutters

zero_cutters

  Title     : zero_cutters
  Function  : A special case if cutters() where enzymes don't cut the sequence
  Returns   : a Bio::Restriction::EnzymeCollection
  Arguments : -
 
 

See also: cutters, unique_cutters

max_cuts

  Title     : max_cuts
  Function  : Find the most number of cuts
  Returns   : The number of times the enzyme that cuts most cuts.
  Arguments : None
 
 

This is not a very practical method, but if you are curious...

Internal methods

_cuts

  Title     : _cuts
  Function  : Figures out which enzymes we know about and cuts the sequence.
  Returns   : Nothing.
  Arguments : None.
  Comments  : An internal method. This will figure out where the sequence 
              should be cut, and provide the appropriate results.
 
 

_enzyme_sites

  Title     : _enzyme_sites
  Function  : An internal method to figure out the two sides of an enzyme
  Returns   : The sequence before the cut and the sequence after the cut
  Arguments : A Bio::Restriction::Enzyme object
 
 

_non_pal_enz

   Title    : _non_pal_enz
   Function : Analyses non_palindromic enzymes for cuts in both ways
   Returns  : A reference to an array of cut positions
   Arguments: The sequence to check and the enzyme object
 
 

_ambig_cuts

  Title     : _ambig_cuts
  Function  : An internal method to localize the cuts in the sequence
  Returns   : A reference to an array of cut positions
  Arguments : The separated enzyme site, the target sequence, and the enzyme object
  Comments  : This is a slow implementation but works for ambiguous sequences.
              Whenever possible, _nonambig_cuts should be used as it is a lot faster.
 
 

_nonambig_cuts

  Title     : _nonambig_cuts
  Function  : Figures out which enzymes we know about and cuts the sequence.
  Returns   : Nothing.
  Arguments : The separated enzyme site, the target sequence, and the enzyme object
 
 

An internal method. This will figure out where the sequence should be cut, and provide the appropriate results. This is a much faster implementation because it doesn't use a regexp, but it can not deal with ambiguous sequences

_mulitple_cuts

  Title     : _multiple_cuts
  Function  : Figures out multiple digests
  Returns   : An array of the cut sites for multiply digested DNA
  Arguments : A Bio::Restriction::EnzymeCollection object
  Comments  : Double digests is one subset of this, but you can use
              as many enzymes as you want.
 
 

_circular

  Title     : _circular
  Function  : Deals with circular sequences
  Returns   : Nothing.
  Arguments : None.
 
 

There are two problems with circular sequences.

   1. When you cut a sequence and rejoin fragments you could generate
   new cut sites.
 
   2. There could be a cut site at the end of the sequence.
 
 

I think these may be the same problem, and so we're working on #2 first!

_expanded_string

  Title     : _expanded_string
  Function  : Expand nucleotide ambiguity codes to their representative letters
  Returns   : The full length string
  Arguments : The string to be expanded.
 
 

Stolen from the original RestrictionEnzyme.pm