Bio::Map::Microsatellite.3pm

Langue: en

Version: 2008-06-24 (ubuntu - 08/07/09)

Section: 3 (Bibliothèques de fonctions)

NAME

Bio::Map::Microsatellite - An object representing a Microsatellite marker.

SYNOPSIS

   $o_usat = new Bio::Map::Microsatellite
       (-name=>'Chad Super Marker 2',
        -sequence => 'gctgactgatcatatatatatatatatatatatatatatatcgcgatcgtga',
        -motif => 'at',
        -repeats => 15,
        -repeat_start_position => 11
        );
 
   $sequence_before_usat = $o_usat->get_leading_flank();
   $sequence_after_usat = $o_usat->get_trailing_flank();
 
 

DESCRIPTION

This object handles the notion of an Microsatellite. This microsatellite can be placed on a (linear) Map or used on its own. If this Microsatellites will be used in a mapping context (it doesn't have to, you know) it can have multiple positions in a map. For information about a Microsatellite's position in a map one must query the associate PositionI object which is accessible through the position() method.

FEEDBACK


Mailing Lists

User feedback is an integral part of the evolution of this and other Bioperl modules. Send your comments and suggestions preferably to the Bioperl mailing list. Your participation is much appreciated.

   bioperl-l@bioperl.org                  - General discussion
   http://bioperl.org/wiki/Mailing_lists  - About the mailing lists
 
 

Reporting Bugs

Report bugs to the Bioperl bug tracking system to help us keep track of the bugs and their resolution. Bug reports can be submitted via the web:

   http://bugzilla.open-bio.org/
 
 

AUTHOR - Chad Matsalla

Email bioinformatics1@dieselwurks.com

CONTRIBUTORS

Heikki Lehvaslaiho heikki-at-bioperl-dot-org Lincoln Stein lstein@cshl.org Jason Stajich jason@bioperl.org Sendu Bala bix@sendu.me.uk

APPENDIX

The rest of the documentation details each of the object methods. Internal methods are usually preceded with a _

new

  Title   : new
  Usage   : $o_usat = 
  Function: Builds a new Bio::Map::Microsatellite object
  Returns : Bio::Map::Microsatellite
  Args    :
         -name    => name of this microsatellite (optional, string,
                 default 'Unknown microsatellite')
         -positions => position(s) for this marker in maps[optional],
                 An array reference of tuples (array refs themselves)
                 Each tuple conatins a Bio::Map::MapI-inherited object and a 
                 Bio::Map::PositionI-inherited obj, no default)
         -sequence => the sequence of this microsatellite (optional,
                  scalar, no default)
         -motif => the repeat motif of this microsatellite (optional,
                  scalar, no default)
         -repeats => the number of motif repeats for this microsatellite
                 (optional, scalar, no default)
         -repeat_start_position => the starting position of the
                 microsatellite in this sequence. The first base of the
                 sequence is position "1". (optional, scalar, no default)
 
  Note    : Creating a Bio::Map::Microsatellite object with no position
         might be useful for microsatellite people wanting to embrace
         and extend this module. <raising hand> Me! Me! Me!
         - using repeat_start_position will trigger a mechinism to
         calculate a value for repeat_end_position.
 
 

motif

  Title   : motif
  Usage   : $o_usat->motif($new_motif);
                my $motif = $o_usat->motif();
  Function: Get/Set the repeat motif for this Microsatellite.
  Returns : A scalar representing the current repeat motif of this
                Microsatellite.
  Args    : none to get, OR string to set
 
 

sequence

  Title   : sequence
  Usage   : $o_usat->sequence($new_sequence);
                my $sequence = $o_usat->sequence();
  Function: Get/Set the sequence for this Microsatellite.
  Returns : A scalar representing the current sequence of this
                Microsatellite.
  Args    : none to get, OR string to set
 
 

repeats

  Title   : repeats
  Usage   : $o_usat->repeats($new_repeats);
                my $repeats = $o_usat->repeats()
  Function: Get/Set the repeat repeats for this Microsatellite.
  Returns : A scalar representing the current number of repeats of this
                Microsatellite.
  Args    : none to get, OR int to set
 
 

repeat_start_position

  Title   : repeat_start_position
  Usage   : $o_usat->repeat_start_position($new_repeat_start_position);
                my $repeat_start_position = $o_usat->repeat_start_position();
  Function: Get/Set the repeat repeat_start_position for this
                Microsatellite
  Returns : A scalar representing the repeat start position for this 
                Microsatellite.
  Args    : none to get, OR string to set
                This method will also try to set the repeat end position. This
                depends on having information for the motif and the number of
                repeats. If you want to use methods like get_trailing_flank or
                get_leading flank, be careful to include the right information.
 
 

repeat_end_position

  Title   : repeat_end_position
  Usage   : $o_usat->repeat_end_position("set");
                $o_usat->repeat_end_position($value);
                $current_repeat_end_position = $o_usat->repeat_end_position();
  Function: Get/set the end position of the repeat in this sequence.
  Returns : A scalar representing the base index of the end of the
                repeat in this Microsatellite. The first base in the sequence
                is base 1.
  Args    : A scalar representing a value, the string "set", or no
                argument (see Notes).
  Notes   : If you do not provide an argument to this method, the current
            end position of the repeat in this Microsatellite will be
            returned (a scalar).
            If you provide the string "set" to this method it will set the
            end position based on the start position, the length of the
            motif, and the number of repeats.
            If you specify a value the current end position of the repeat
            will be set to that value. This is a really bad idea. Don't do
            it.
 
 

equals

  Title   : equals
  Usage   : if ($mappable->equals($mapable2)) {...}
  Function: Test if a position is equal to another position
  Returns : boolean
  Args    : Bio::Map::MappableI
 
 

less_than

  Title   : less_than
  Usage   : if ($mappable->less_than($m2)) {...}
  Function: Tests if a position is less than another position
  Returns : boolean
  Args    : Bio::Map::MappableI
 
 

greater_than

  Title   : greater_than
  Usage   : if ($mappable->greater_than($m2)) {...}
  Function: Tests if position is greater than another position
  Returns : boolean
  Args    : Bio::Map::MappableI
 
 

get_leading_flank

  Title   : get_leading_flank
  Usage   : $leading_sequence = $o_usat->get_leading_flank();
  Returns : A scalar representing the sequence before the repeats in this
                Microsatellite.
  Args    : none
 
 

get_trailing_flank

  Title   : get_trailing_flank
  Usage   : $trailing_flank = $o_usat->get_trailing_flank();
  Returns : A scalar representing the sequence after the repeats in this
                Microsatellite.
  Args    : none